Skip to main content

Table 1 Primers sequences used for Real-time PCR analysis

From: Angiotensin II type 1 receptor (AT1) blockade by Telmisartan attenuates hepatic steatosis in high-fat fed mice reducing Resistin, TRL4, and Myd88 expression

Gene Forward primer Reverse primer
GAPDH (NM_011146) 5′AAGAAGGTGGTGAAGCAGGCATC3′ 5′CGAAGGTGGAAGAGTGGGAGTTG3′
TRL4 (NM_007678) 5′TTCAGCTCTGGGATGACCTT3′ 5′GCCGTTAGTGAAGAGTCTCAGTTTG3′
RESISTIN (NM_007643) 5′TAGTAGAACCGGCCACGTA3′ 5′CAGTTCCGATCACAGCCCAT3′
MYD88 (NM_009127) 5′CATCGCCTGCTCTACCCTTT3′ 5′GAACTGCGCTTGGAAACCTG3′